Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03411

HP ID(1) HP03411
Gene ID(2) 57142
Gene Symbol finder RTN4
Protein Name reticulon 4
RefSeq NM_020532.4
Length of RefSeq (bp) 4871
Chromosome 2p16.3
Reference DDBJ accession
UniGene Hs.704007

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26E07 pKA1U5 GGAGAGTCCGCTGGCCTCACTCCTAGCTCATCTGGGCGGCGGCGGCAACTGGGGACAGGG
ARe39E10 pKA1U5 GACTCCTAGCTCATCTGGGCGGCGGCGGCAACTGGGGACAGGGCGGGTGGCGCATCACCG
ARe48F01 pKA1U5 GAGGGCGGGTGGCGCATCACCGGCGCGGAGGCAGGAGGAGCAGTCTCATTGTTCCGGGAG
ARe59B10 pKA1U5 GGACAGGGCGGGTGGCGCATCACCGGCGCGGAGGCAGGAGGAGCAGTCTCATTGTTCCGG
ARe65G09 pKA1U5 GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
ARe97C02 pKA1U5 GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
ARi28H12 pGCAP10 GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
ARi33D03 pGCAP10 GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
ARi39E07 pGCAP10 GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
ARi44G04 pGCAP10 GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
ARiS013M04 pGCAP10 GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
ARiS055C01 pGCAP10 GACAGGGCGGGTGGCGCATCACCGGCGCGGAGGCAGGAGGAGCAGTCTCATTGTTCCGGG
RBd26G10 pGCAP10 GTGGCCTCACTCCTAGCTCATCTGGGCGGCGGCGGCAAGTGGGGACAGGGCGGGTGGCGC
RBdS040J05 pGCAP10 GGCGGCCCCGGCGGCGGCGGCAGCAGCTGCAGCATCATCTCCACCCTCCAGCCATGGAAG
RBdS051M15 pGCAP10 GACTCCTAGCTCATCTGGGCGGCGGCGGCAAGTGGGGACAGGGCGGGTGGCGCATCACCG
RBdS104K11 pGCAP10 GATTGTTCCGGGAGCCGTCACCACANTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTN
RBdS104P04 pGCAP10 GGCGGAGAGTCCGCTGGCCTCACTCCTAGCTCATCTGGGCGGCGGCGGCAAGTGGGGACA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl