RBd26G10 NRCD Human cDNA Clone

Prev. | Human A to Z list > R > RTN4 >

RBd26G10 - NRCD Human cDNA Clone


Catalog Number	HKR370554
Clone Name	RBd26G10
Clone info.	Plasmid clone of human RTN4 cDNA with SV40 promoter
Vector Click for information	pGCAP10
5'-terminal sequence⁽¹⁾	GTGGCCTCACTCCTAGCTCATCTGGGCGGCGGCGGCAAGTGGGGACAGGGCGGGTGGCGC
Sequence, submitted⁽²⁾	n.a.
Sequence, refered	NM_020532.4 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽³⁾	RTN4 (NCBI Gene 57142) other clone of RTN4 in our bank
Synonyms	ASY\|NI220/250\|NOGO\|NSP\|NSP-CL\|Nbla00271\|Nbla10545\|RTN-X\|RTN4-A\|RTN4-B1\|RTN4-B2\|RTN4-C
Protein Name	reticulon 4

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR370554	RBd26G10	DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (by primer A)	Seq File (by primer B)	Seq File (by primer C)	Seq File (contig)	PDF File
RBd26G10a.seq		RBd26G10c.seq		RBd26G10.pdf