Prev. |  KEGG KO K20720 > 

RIKEN DNA Bank Human Resource - RTN4

Gene ID NCBI Gene 57142 |  KEGG hsa:57142
Gene Symbol RTN4
Protein Name reticulon 4
Synonyms ASY|NI220/250|NOGO|NSP|NSP-CL|Nbla00271|Nbla10545|RTN-X|RTN4-A|RTN4-B1|RTN4-B2|RTN4-C
Ortholog resource in our bank

  RTN4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021924 W01A054N12 pENTR-TOPO flj0062i13 AK129806 NM_153828 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050503 ARe26E07 pKA1U5 NM_020532.4 done
GGAGAGTCCGCTGGCCTCACTCCTAGCTCATCTGGGCGGCGGCGGCAACTGGGGACAGGG
HKR055706 ARe39E10 pKA1U5 NM_020532.4 done
GACTCCTAGCTCATCTGGGCGGCGGCGGCAACTGGGGACAGGGCGGGTGGCGCATCACCG
HKR059321 ARe48F01 pKA1U5 NM_020532.4 done
GAGGGCGGGTGGCGCATCACCGGCGCGGAGGCAGGAGGAGCAGTCTCATTGTTCCGGGAG
HKR063634 ARe59B10 pKA1U5 NM_020532.4 done
GGACAGGGCGGGTGGCGCATCACCGGCGCGGAGGCAGGAGGAGCAGTCTCATTGTTCCGG
HKR066153 ARe65G09 pKA1U5 NM_020532.4 done
GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
HKR078850 ARe97C02 pKA1U5 NM_020532.4 done
GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
HKR171380 ARi28H12 pGCAP10 NM_020532.4 done
GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
HKR173275 ARi33D03 pGCAP10 NM_020532.4 done
GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
HKR175703 ARi39E07 pGCAP10 NM_020532.4 done
GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
HKR177748 ARi44G04 pGCAP10 NM_020532.4 done
GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
HKR205492 ARiS013M04 pGCAP10 NM_020532.4 done
GATTGTTCCGGGAGCCGTCACCACAGTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTC
HKR222049 ARiS055C01 pGCAP10 NM_020532.4 done
GACAGGGCGGGTGGCGCATCACCGGCGCGGAGGCAGGAGGAGCAGTCTCATTGTTCCGGG
HKR370554 RBd26G10 pGCAP10 NM_020532.4 done
GTGGCCTCACTCCTAGCTCATCTGGGCGGCGGCGGCAAGTGGGGACAGGGCGGGTGGCGC
HKR416221 RBdS040J05 pGCAP10 NM_020532.4 done
GGCGGCCCCGGCGGCGGCGGCAGCAGCTGCAGCATCATCTCCACCCTCCAGCCATGGAAG
HKR420703 RBdS051M15 pGCAP10 NM_020532.4 done
GACTCCTAGCTCATCTGGGCGGCGGCGGCAAGTGGGGACAGGGCGGGTGGCGCATCACCG
HKR441851 RBdS104K11 pGCAP10 NM_020532.4 done
GATTGTTCCGGGAGCCGTCACCACANTAGGTCCCTCGGCTCAGTCGGCCCAGCCCCTCTN
HKR441964 RBdS104P04 pGCAP10 NM_020532.4 done
GGCGGAGAGTCCGCTGGCCTCACTCCTAGCTCATCTGGGCGGCGGCGGCAAGTGGGGACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl