Prev. |  Human A to Z list >  R >  RTN4 > 

ARe26E07 - NRCD Human cDNA Clone

Catalog Number HKR050503
Clone Name ARe26E07
Clone info. Plasmid clone of human RTN4 cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGAGAGTCCGCTGGCCTCACTCCTAGCTCATCTGGGCGGCGGCGGCAACTGGGGACAGGG
Sequence, submitted(2) n.a.
Note Corresponding transcript variant 2 (NM_153828).
 
Sequence, refered NM_020532.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RTN4 (NCBI Gene 57142)  other clone of RTN4 in our bank
Synonyms ASY|NI220/250|NOGO|NSP|NSP-CL|Nbla00271|Nbla10545|RTN-X|RTN4-A|RTN4-B1|RTN4-B2|RTN4-C
Protein Name reticulon 4
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR050503 ARe26E07 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARe26E07a.seq   ARe26E07c.seq   ARe26E07.pdf

References and tips

Featured content

Reference


2021.08.05

NRCDhumcloneList_AR_210404.csv - GNP_filter3_NRCD_html_190131.pl