Prev. |  Human A to Z list >  R >  RTN4 > 

ARe48F01 - NRCD Human cDNA Clone

Catalog Number HKR059321
Clone Name ARe48F01
Clone info. Plasmid clone of human RTN4 cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) GAGGGCGGGTGGCGCATCACCGGCGCGGAGGCAGGAGGAGCAGTCTCATTGTTCCGGGAG
Sequence, submitted(3) n.a.
 
Sequence, refered NM_020532.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) RTN4 (NCBI Gene 57142)  other clone of RTN4 in our bank
Synonyms ASY|NI220/250|NOGO|NSP|NSP-CL|Nbla00271|Nbla10545|RTN-X|RTN4-A|RTN4-B1|RTN4-B2|RTN4-C
Protein Name reticulon 4
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR059321 ARe48F01 DNA solution

How to cite this biological resource

Materials & Methods section:

The ARe48F01 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR059321).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARe48F01a.seq   ARe48F01c.seq   ARe48F01.pdf

References and tips

Featured content

Reference


2023.05.03

NRCDhumcloneList_AR_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl