Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02136

HP ID(1) HP02136
Gene ID(2) 5886
Gene Symbol finder RAD23A
Protein Name RAD23 homolog A (S. cerevisiae)
RefSeq NM_005053.2
Length of RefSeq (bp) 1793
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.643267

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe47F02 pKA1U5 GGCGCGCCTGGGCGCTAAGATGGCGGCGGCGCTGAGTTTGCATGTTGTGTGAGGATCCCG
ARe53D05 pKA1U5 GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGCTGAGATTGCATGTTGTGTGAGGATC
ARiS087J03 pGCAP10 GGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGC
RBb67E08 pGCAP1 GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCC
RBb70G07 pGCAP1 GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCC
RBd41D07 pGCAP10 GGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGCGTCG
RBd89C11 pGCAP10 GCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCC
RBdS156D02 pGCAP10 GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl