Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156D02

Clone ID RBdS156D02
HP ID HP02136
Gene ID 5886
Gene Symbol RAD23A
Protein Name RAD23 homolog A (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005053.2
Length of RefSeq (bp) 1793
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.643267
5'-terminal sequence GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCC
2011.08.28