Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAD23A

Gene ID (NCBI) 5886
Gene Symbol RAD23A
Protein Name RAD23 homolog A (S. cerevisiae)
Synonyms HHR23A|HR23A
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY091481 IRAL028L17 pOTB7 BC014026 NM_005053 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE025002 W01A062I10 pENTR-TOPO IRAL028L17 BC014026 NM_005053
HGE025004 W01A062I12 pENTR-TOPO IRAL028L17 BC014026 NM_005053

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR058922 ARe47F02 pKA1U5 NM_005053.2
GGCGCGCCTGGGCGCTAAGATGGCGGCGGCGCTGAGTTTGCATGTTGTGTGAGGATCCCG
HKR061277 ARe53D05 pKA1U5 NM_005053.2
GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGCTGAGATTGCATGTTGTGTGAGGATC
HKR235019 ARiS087J03 pGCAP10 NM_005053.2
GGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGC
HKR376479 RBd41D07 pGCAP10 NM_005053.2
GGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGCGTCG
HKR346904 RBb67E08 pGCAP1 NM_005053.2
GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCC
HKR348151 RBb70G07 pGCAP1 NM_005053.2
GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCC
HKR395659 RBd89C11 pGCAP10 NM_005053.2
GCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCC
HKR462474 RBdS156D02 pGCAP10 NM_005053.2
GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl