Prev. |  KEGG KO K10839 > 

RIKEN DNA Bank Human Resource - RAD23A

Gene ID NCBI Gene 5886 |  KEGG hsa:5886
Gene Symbol RAD23A
Protein Name RAD23 homolog A, nucleotide excision repair protein
Synonyms HHR23A|HR23A
Featured content DNA repair (human)
Ortholog resource in our bank

  RAD23A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091481 IRAL028L17 pOTB7 BC014026 NM_005053 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025002 W01A062I10 pENTR-TOPO IRAL028L17 BC014026 NM_005053  
HGE025004 W01A062I12 pENTR-TOPO IRAL028L17 BC014026 NM_005053  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058922 ARe47F02 pKA1U5 NM_005053.2  
GGCGCGCCTGGGCGCTAAGATGGCGGCGGCGCTGAGTTTGCATGTTGTGTGAGGATCCCG
HKR061277 ARe53D05 pKA1U5 NM_005053.2  
GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGCTGAGATTGCATGTTGTGTGAGGATC
HKR235019 ARiS087J03 pGCAP10 NM_005053.2  
GGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGC
HKR346904 RBb67E08 pGCAP1 NM_005053.2  
GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCC
HKR348151 RBb70G07 pGCAP1 NM_005053.2  
GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCC
HKR376479 RBd41D07 pGCAP10 NM_005053.2  
GGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGCGTCG
HKR395659 RBd89C11 pGCAP10 NM_005053.2  
GCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCC
HKR462474 RBdS156D02 pGCAP10 NM_005053.2  
GGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl