Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - ARe47F02

Clone ID ARe47F02
HP ID HP02136
Gene ID 5886
Gene Symbol RAD23A
Protein Name RAD23 homolog A (S. cerevisiae)
Vector pKA1U5
Accession No. in DDBJ
RefSeq NM_005053.2
Length of RefSeq (bp) 1793
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.643267
5'-terminal sequence GGCGCGCCTGGGCGCTAAGATGGCGGCGGCGCTGAGTTTGCATGTTGTGTGAGGATCCCG
2011.08.28