Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00341

HP ID(1) HP00341
Gene ID(2) 6175
Gene Symbol finder RPLP0
Protein Name ribosomal protein, large, P0
RefSeq NM_001002.3
Length of RefSeq (bp) 1229
Chromosome 12q24.2
Reference DDBJ accession
UniGene Hs.546285

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06B04 pKA1U5 GCTCTCGCCAGGCGTCCTCGNTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
ARe07H01 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGNTCTTTAAACCCTGCGTGGCAATCCC
ARe10D03 pKA1U5 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGNTCTTTAAACCCTGCGTGGCAA
ARe14H10 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARe19D09 pKA1U5 GCCCTTCTCTCGCCAGGCGTCCTCGATGGAAGTGACATCGCTCTTTAAACCCTGCGTGGC
ARe23G02 pKA1U5 GCTCTCGCCAGGCGTCCTCGNTGGAAGTGACATCNCTTTTTAAACCCTGCGTGGCAATCC
ARe23H04 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARe26B11 pKA1U5 GCTCTCGCCAGGCGTCCTCGTTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGCTGAC
ARe26F04 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARe30C06 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARe33A01 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCCC
ARe35C12 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCCC
ARe38H08 pKA1U5 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATNGTTCTTTAAACCCTGCGTGGCAA
ARe38H12 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCCC
ARe42G11 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCCC
ARe45H12 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARe46E11 pKA1U5 GCCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGNTCTTTAAACCCTGCGTGGCA
ARe66C02 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGNTCTTTAAACCCTGCGTGGCAATCCC
ARe67C06 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARe68A06 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARe68C07 pKA1U5 GCTCTCGCCAGGCGTTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCC
ARe68G06 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTTCTTTAAACCCTGCGTGGCAATCCC
ARe70E11 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
ARe83A09 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARe87E10 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARe90B08 pKA1U5 ATTGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
ARe93H07 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
ARe95C12 pKA1U5 GCTNTCNCCAGGTGCTCCTCCTGGAAGGNCNGGGTACCGNGGGATGGGTGTCAGCNATGA
ARf07C06 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
ARi03D06 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARi03H04 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
ARi06B09 pGCAP10 NCNNNCGCCAGGCGTCCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
ARi07D02 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARi09D01 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
ARi10B02 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
ARi11D04 pGCAP10 GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
ARi11E05 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARi13A06 pGCAP10 TGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
ARi13F05 pGCAP10 TGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
ARi19B10 pGCAP10 GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
ARi27F04 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARi31D05 pGCAP10 GCCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAA
ARi31D10 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
ARi43H07 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
ARi44B11 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARi46A11 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARi52H09 pGCAP10 GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
ARi55A02 pGCAP10 GTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTG
ARi55H11 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARi56A11 pGCAP10 GTCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
ARi59D12 pGCAP10 TGCTTCTCTCCCCCGGCTTCCTCGTGGAAGTGAATCGTCTTTAANCCCTGCGTGGCAATC
ARi65D02 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
ARi67D10 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
ARi68C01 pGCAP10 GTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
ARi68E09 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARi70A05 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARi70C09 pGCAP10 TGTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
ARi70D11 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS008C12 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
ARiS008H20 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS008I20 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS008J07 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS020N13 pGCAP10 GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
ARiS023L19 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
ARiS045O06 pGCAP10 CGGCCGGCCGATGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGC
ARiS049E02 pGCAP10 GTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
ARiS049G24 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
ARiS049K01 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS049K05 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
ARiS055M17 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS085E07 pGCAP10 TGTCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGAC
ARiS088C22 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS088L17 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS088O06 pGCAP10 TGGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
ARiS096G01 pGCAP10
ARiS109J13 pGCAP10 TTGCTCTCCNCNNGCGTCCTCNTGGAAGTGACATCNNCTTNNAACCCTGCNTGNCAATCC
ARiS118L06 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS118N17 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS122M12 pGCAP10 TGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
ARiS150B18 pGCAP10 CCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS150P17 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
ARiS161A10 pGCAP10 GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
ARiS161F24 pGCAP10 NCTCCCTCCCNGNGTCCTCATGAAGNTNAGNTCGTCTTNNANNNNNNCNNNNCNNTNCNN
ARiS161L10 pGCAP10 GGCCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCA
ARiS191E24 pGCAP10 GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
ARiS191P15 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS194O21 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
ARiS198P14 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
RBb01H12 pKA1U5 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGATCTTTAAACCCTGCGTGGCAA
RBb02B08 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGNTCTTTAAACCCTGCGTGGCAATCCC
RBb02D12 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBb14H06 pKA1U5 GCTCTCGCCAGGCGNTCCTCGTTGGAAGTGACATCGTTCTTTAAACCCTGCGTGGCAATC
RBb17D09 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
RBb17H07 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBb18C08 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCCC
RBb19G07 pKA1U5 GCTCTCGCCAGGCGTCCTCGTGGAAGCAACTATTGGATGATTATCCGAAATGTTTCATTG
RBb21E10 pKA1U5 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBb23D03 pGCAP1 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
RBb28C08 pGCAP1 TTGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
RBb29C07 pGCAP1 GGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
RBb30G04 pGCAP1 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
RBb34G09 pGCAP1 GCTCTCTCGCCAGGCGTCCTCGTGGAAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
RBb43B03 pGCAP1 GCTCTCGCCAGGCGTCCTCGCTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
RBb45C05 pGCAP1 GGCTTCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTG
RBb45F09 pGCAP1 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBb47D02 pGCAP1
RBb50F04 pGCAP1 CTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTG
RBb51E03 pGCAP1 GCTCTCGCCAGGGCGATCCTCGTGGTAAGATGACATCGNTCTTTTAAACCCTTGNCGTGG
RBb54C08 pGCAP1 GCTTCTCTCGCCAGGCGTTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBb59G04 pGCAP1 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBb60C02 pGCAP1 AGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
RBb61A04 pGCAP1 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBb70F12 pGCAP1 AGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
RBd02C12 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd02E12 pGCAP10 CCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGA
RBd02H01 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
RBd03E11 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
RBd03H08 pGCAP10 TGCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACC
RBd06C11 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBd07D01 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd09A11 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd13H11 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBd19A01 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd20F10 pGCAP10 GTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
RBd21A03 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd22D10 pGCAP10
RBd23C03 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd25F11 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBd35G05 pGCAP10 GTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
RBd36F05 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
RBd37G02 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd40B09 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd44E07 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd48D11 pGCAP10 GCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGA
RBd49B07 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBd49C05 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBd50B10 pGCAP10 GGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGC
RBd53D05 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
RBd58D08 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd62C11 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
RBd68E01 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd70C07 pGCAP10 TGCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBd76C08 pGCAP10 GGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGC
RBd82B06 pGCAP10 GTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
RBd83D04 pGCAP10 GCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGA
RBd86C07 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBd90A10 pGCAP10 GGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGC
RBd94G01 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBd97C02 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBdS007C23 pGCAP10 GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
RBdS013B22 pGCAP10 GGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGC
RBdS014L17 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBdS022B17 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBdS051O19 pGCAP10 CGGCCGGCCGATGCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCC
RBdS070B07 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBdS070L09 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBdS070M21 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
RBdS075F03 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBdS081E01 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBdS081L14 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBdS104I10 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBdS105J19 pGCAP10 TGGCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAA
RBdS110G06 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBdS154E17 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBdS156A12 pGCAP10 GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
RBdS156I15 pGCAP10 GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
RBdS156M07 pGCAP10 GTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl