Prev. |  KEGG KO K02941 > 

RIKEN DNA Bank Human Resource - RPLP0

Gene ID NCBI Gene 6175 |  KEGG hsa:6175
Gene Symbol RPLP0
Protein Name ribosomal protein lateral stalk subunit P0
Synonyms L10E|LP0|P0|PRLP0|RPP0
Ortholog resources KEGG ortholog (KEGG orthology K02941) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004818 IRAK012A18 pCMV-SPORT6 BC008092 NM_053275 Full
HGX007645 IRAK019B21 pCMV-SPORT6 BC008594 NM_053275 Full
HGX008954 IRAK022G10 pCMV-SPORT6 BC015173 NM_053275 Full
HGY080653 IRAL001K13 pOTB7 BC000345 NM_053275 Full
HGY081088 IRAL002L24 pOTB7 BC000752 NM_053275 Full
HGY081561 IRAL003P01 pOTB7 BC001127 NM_053275 Full/var
HGY083106 IRAL007M18 pOTB7 BC000087 NM_053275 Full
HGY084019 IRAL010A19 pOTB7 BC005863 NM_053275 Full
HGY084290 IRAL010M02 pOTB7 BC001834 NM_053275 Full
HGY084514 IRAL011E18 pOTB7 BC003655 NM_053275 Full
HGY090119 IRAL025E23 pOTB7 BC009867 NM_053275 Full
HGY093439 IRAL033J23 pOTB7 BC015690 NM_053275 Full
HGY103040 IRAL057J24 pDNR-LIB BC070194 NM_053275 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042428 ARe06B04 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGNTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR042969 ARe07H01 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGNTCTTTAAACCCTGCGTGGCAATCCC
HKR044075 ARe10D03 pKA1U5 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGNTCTTTAAACCCTGCGTGGCAA
HKR045778 ARe14H10 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR047681 ARe19D09 pKA1U5 NM_001002.3  
GCCCTTCTCTCGCCAGGCGTCCTCGATGGAAGTGACATCGCTCTTTAAACCCTGCGTGGC
HKR049346 ARe23G02 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGNTGGAAGTGACATCNCTTTTTAAACCCTGCGTGGCAATCC
HKR049372 ARe23H04 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR050435 ARe26B11 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGCTGAC
HKR050524 ARe26F04 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR052054 ARe30C06 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR053201 ARe33A01 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCCC
HKR054060 ARe35C12 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCCC
HKR055376 ARe38H08 pKA1U5 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATNGTTCTTTAAACCCTGCGTGGCAA
HKR055380 ARe38H12 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCCC
HKR056955 ARe42G11 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCCC
HKR058180 ARe45H12 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR058507 ARe46E11 pKA1U5 NM_001002.3  
GCCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGNTCTTTAAACCCTGCGTGGCA
HKR066450 ARe66C02 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGNTCTTTAAACCCTGCGTGGCAATCCC
HKR066854 ARe67C06 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR067206 ARe68A06 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR067255 ARe68C07 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCC
HKR067350 ARe68G06 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTTCTTTAAACCCTGCGTGGCAATCCC
HKR068107 ARe70E11 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
HKR073209 ARe83A09 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR074906 ARe87E10 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR076032 ARe90B08 pKA1U5 NM_001002.3  
ATTGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR077375 ARe93H07 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
HKR078060 ARe95C12 pKA1U5 NM_001002.3  
GCTNTCNCCAGGTGCTCCTCCTGGAAGGNCNGGGTACCGNGGGATGGGTGTCAGCNATGA
HKR161278 ARi03D06 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR161372 ARi03H04 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR162433 ARi06B09 pGCAP10 NM_001002.3  
NCNNNCGCCAGGCGTCCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR162874 ARi07D02 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR163673 ARi09D01 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR164026 ARi10B02 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR164476 ARi11D04 pGCAP10 NM_001002.3  
GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
HKR164501 ARi11E05 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR165206 ARi13A06 pGCAP10 NM_001002.3  
TGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR165325 ARi13F05 pGCAP10 NM_001002.3  
TGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR167634 ARi19B10 pGCAP10 NM_001002.3  
GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
HKR170924 ARi27F04 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR172477 ARi31D05 pGCAP10 NM_001002.3  
GCCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAA
HKR172482 ARi31D10 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR177375 ARi43H07 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
HKR177635 ARi44B11 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR178411 ARi46A11 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR180977 ARi52H09 pGCAP10 NM_001002.3  
GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
HKR182002 ARi55A02 pGCAP10 NM_001002.3  
GTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTG
HKR182179 ARi55H11 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR182411 ARi56A11 pGCAP10 NM_001002.3  
GTCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR183684 ARi59D12 pGCAP10 NM_001002.3  
TGCTTCTCTCCCCCGGCTTCCTCGTGGAAGTGAATCGTCTTTAANCCCTGCGTGGCAATC
HKR186074 ARi65D02 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR186882 ARi67D10 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
HKR187249 ARi68C01 pGCAP10 NM_001002.3  
GTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR187305 ARi68E09 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR188005 ARi70A05 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR188057 ARi70C09 pGCAP10 NM_001002.3  
TGTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
HKR188083 ARi70D11 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR203260 ARiS008C12 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR203388 ARiS008H20 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR203412 ARiS008I20 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR203423 ARiS008J07 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR208325 ARiS020N13 pGCAP10 NM_001002.3  
GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
HKR209483 ARiS023L19 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR218342 ARiS045O06 pGCAP10 NM_001002.3  
CGGCCGGCCGATGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGC
HKR219698 ARiS049E02 pGCAP10 NM_001002.3  
GTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR219768 ARiS049G24 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR219841 ARiS049K01 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR219845 ARiS049K05 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR222305 ARiS055M17 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR234103 ARiS085E07 pGCAP10 NM_001002.3  
TGTCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGAC
HKR235270 ARiS088C22 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR235481 ARiS088L17 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR235542 ARiS088O06 pGCAP10 NM_001002.3  
TGGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
HKR238545 ARiS096G01 pGCAP10 NM_001002.3  
HKR243829 ARiS109J13 pGCAP10 NM_001002.3  
TTGCTCTCCNCNNGCGTCCTCNTGGAAGTGACATCNNCTTNNAACCCTGCNTGNCAATCC
HKR247470 ARiS118L06 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR247529 ARiS118N17 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR249100 ARiS122M12 pGCAP10 NM_001002.3  
TGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR260042 ARiS150B18 pGCAP10 NM_001002.3  
CCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR260377 ARiS150P17 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
HKR264410 ARiS161A10 pGCAP10 NM_001002.3  
GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
HKR264544 ARiS161F24 pGCAP10 NM_001002.3  
NCTCCCTCCCNGNGTCCTCATGAAGNTNAGNTCGTCTTNNANNNNNNCNNNNCNNTNCNN
HKR264674 ARiS161L10 pGCAP10 NM_001002.3  
GGCCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCA
HKR276520 ARiS191E24 pGCAP10 NM_001002.3  
GCTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
HKR276775 ARiS191P15 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR277957 ARiS194O21 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR279574 ARiS198P14 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
HKR320580 RBb01H12 pKA1U5 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGATCTTTAAACCCTGCGTGGCAA
HKR320832 RBb02B08 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGNTCTTTAAACCCTGCGTGGCAATCCC
HKR320884 RBb02D12 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR325774 RBb14H06 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGNTCCTCGTTGGAAGTGACATCGTTCTTTAAACCCTGCGTGGCAATC
HKR326881 RBb17D09 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
HKR326975 RBb17H07 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR327256 RBb18C08 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGCTCTTTAAACCCTGCGTGGCAATCCC
HKR327751 RBb19G07 pKA1U5 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGCAACTATTGGATGATTATCCGAAATGTTTCATTG
HKR328506 RBb21E10 pKA1U5 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR329275 RBb23D03 pGCAP1 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR331256 RBb28C08 pGCAP1 NM_001002.3  
TTGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCC
HKR331655 RBb29C07 pGCAP1 NM_001002.3  
GGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR332148 RBb30G04 pGCAP1 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR333753 RBb34G09 pGCAP1 NM_001002.3  
GCTCTCTCGCCAGGCGTCCTCGTGGAAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR337227 RBb43B03 pGCAP1 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGCTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR338053 RBb45C05 pGCAP1 NM_001002.3  
GGCTTCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTG
HKR338129 RBb45F09 pGCAP1 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR338874 RBb47D02 pGCAP1 NM_001002.3  
HKR340124 RBb50F04 pGCAP1 NM_001002.3  
CTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTG
HKR340499 RBb51E03 pGCAP1 NM_001002.3  
GCTCTCGCCAGGGCGATCCTCGTGGTAAGATGACATCGNTCTTTTAAACCCTTGNCGTGG
HKR341656 RBb54C08 pGCAP1 NM_001002.3  
GCTTCTCTCGCCAGGCGTTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR343748 RBb59G04 pGCAP1 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR344050 RBb60C02 pGCAP1 NM_001002.3  
AGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR344404 RBb61A04 pGCAP1 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR348132 RBb70F12 pGCAP1 NM_001002.3  
AGCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR360860 RBd02C12 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR360908 RBd02E12 pGCAP10 NM_001002.3  
CCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGA
HKR360969 RBd02H01 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR361307 RBd03E11 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR361376 RBd03H08 pGCAP10 NM_001002.3  
TGCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACC
HKR362459 RBd06C11 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR362873 RBd07D01 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR363611 RBd09A11 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR365379 RBd13H11 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR367601 RBd19A01 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR368130 RBd20F10 pGCAP10 NM_001002.3  
GTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR368403 RBd21A03 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR368882 RBd22D10 pGCAP10 NM_001002.3  
HKR369251 RBd23C03 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR370131 RBd25F11 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR374149 RBd35G05 pGCAP10 NM_001002.3  
GTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR374525 RBd36F05 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
HKR374946 RBd37G02 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR376033 RBd40B09 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR377703 RBd44E07 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR379283 RBd48D11 pGCAP10 NM_001002.3  
GCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGA
HKR379631 RBd49B07 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR379653 RBd49C05 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR380034 RBd50B10 pGCAP10 NM_001002.3  
GGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGC
HKR381277 RBd53D05 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR383280 RBd58D08 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR384859 RBd62C11 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR387297 RBd68E01 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR388055 RBd70C07 pGCAP10 NM_001002.3  
TGCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR390456 RBd76C08 pGCAP10 NM_001002.3  
GGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGC
HKR392830 RBd82B06 pGCAP10 NM_001002.3  
GTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCC
HKR393276 RBd83D04 pGCAP10 NM_001002.3  
GCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGA
HKR394455 RBd86C07 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR396010 RBd90A10 pGCAP10 NM_001002.3  
GGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGC
HKR397745 RBd94G01 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR398850 RBd97C02 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR402871 RBdS007C23 pGCAP10 NM_001002.3  
GCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATC
HKR405246 RBdS013B22 pGCAP10 NM_001002.3  
GGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGC
HKR405881 RBdS014L17 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR408841 RBdS022B17 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR420755 RBdS051O19 pGCAP10 NM_001002.3  
CGGCCGGCCGATGCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCC
HKR428031 RBdS070B07 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR428273 RBdS070L09 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR428309 RBdS070M21 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
HKR430123 RBdS075F03 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR432497 RBdS081E01 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR432678 RBdS081L14 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR441802 RBdS104I10 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR442235 RBdS105J19 pGCAP10 NM_001002.3  
TGGCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAA
HKR444150 RBdS110G06 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR461713 RBdS154E17 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR462412 RBdS156A12 pGCAP10 NM_001002.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
HKR462607 RBdS156I15 pGCAP10 NM_001002.3  
GCCTTCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAAT
HKR462695 RBdS156M07 pGCAP10 NM_001002.3  
GTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl