Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104I10

Clone ID RBdS104I10
HP ID HP00341
Gene ID 6175
Gene Symbol RPLP0
Protein Name ribosomal protein, large, P0
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001002.3
Length of RefSeq (bp) 1229
Chromosome 12q24.2
Reference DDBJ accession
UniGene Hs.546285
5'-terminal sequence GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT
2011.08.28