Prev. |  Human A to Z list >  R >  RPLP0 > 

ARf07C06 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR082854
Clone Name ARf07C06
Clone info. Plasmid clone of human RPLP0 cDNA with SV40 promoter
Vector plasmidClick for information pKA1U5
5'-terminal sequence(1) GCTCTCGCCAGGCGTCCTCGTGGAAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCA
Sequence, submitted(2) n.a.
 
Sequence, refered NM_001002.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RPLP0 (NCBI Gene 6175) finder other clone of RPLP0 in our bank
Synonyms L10E|LP0|P0|PRLP0|RPP0
Protein Name ribosomal protein, large, P0
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Catalog # Clone name Availability
HKR082854 ARf07C06 This clone has been withdrawn.

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference


2017.10.27

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_171016.pl