Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATPIF1

Gene ID (NCBI) 93974
Gene Symbol ATPIF1
Protein Name ATPase inhibitory factor 1
Synonyms ATPI|ATPIP|IP
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005640 IRAK014B16 pCMV-SPORT6 BC009677 NM_178191 Full
HGY085540 IRAL013O04 pOTB7 BC004955 NM_178191 Partial
HGY090055 IRAL025C07 pOTB7 BC017562 NM_178191 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164454 ARi11C06 pGCAP10 NM_016311.3  
GAGAGACGCCAGGGGTGCAGCTCCAGCAGCAATGGCAGTGACGGCGTTGGCGGCGCGGAC
HKR168009 ARi20A09 pGCAP10 NM_016311.3  
GAGAGACGCCAGGGGTGCAGCTCCAGCAGCAATGGCAGTGACGGCGTTGGCGGCGCGGAC
HKR170925 ARi27F05 pGCAP10 NM_016311.3  
GAGAGACGCCAGGGGTGCAGCTCCAGCAGCAATGGCAGTGACGGCGTTGGCGGCGCGGAC
HKR075251 ARe88C03 pKA1U5 NM_016311.3  
GAGAGACGCCAGGGGTGCAGCTCCAGCAGCAATGGCAGTGACGGCGTTGGCGGCGCGGAC
HKR079328 ARe98F08 pKA1U5 NM_016311.3  
GAGCGCGTAACGAGAGACTGCTTGCTGCGGCAGAGACGCCAGGGGTGCAGCTCCAGCAGC
HKR222244 ARiS055K04 pGCAP10 NM_016311.3  
CGGCCGGCCGATGANAGACGCCAGGGGTGCAGCTCCAGCAGCAATGGCAGTGACGGCGTT
HKR264658 ARiS161K18 pGCAP10 NM_016311.3  
GAGCGCGTAACGAGAGACTGCTTGCTGCGGCAGAGACGCCAGGGGTGCAGCTCCAGCAGC
HKR325705 RBb14E09 pKA1U5 NM_016311.3  
GGCTTGCTGCGGCAGAGACGCCAGAGGTGCAGCTCCAGCAGCAATGGCAGTGACGGCGTT
HKR364859 RBd12C11 pGCAP10 NM_016311.3  
GGCGCGTAACGAGAGACTGCTTGCTGCGGCAGAGACGCCAGAGGTGCAGCTCCAGCAGCA
HKR367330 RBd18F10 pGCAP10 NM_016311.3  
GACGCCAGGGGTGCAGCTCCAGCAGCAATGGCAGTGACGGCGTTGGCGGCGCGGACGTGG
HKR332173 RBb30H05 pGCAP1 NM_016311.3  
CGGAGAGACGCCAGGGGTGCAGCTCCAGCAGCAATGGCAGTGACGGCGTTGGCGGCGCGG
HKR377684 RBd44D12 pGCAP10 NM_016311.3  
GGAGAGACTGCTTGCTGCGGCAGAGACGCCAGAGGTGCAGCTCCAGCAGCAATGGCAGTG
HKR340884 RBb52D12 pGCAP1 NM_016311.3  
GAGAGACGCCAGAGGTGCAGCTTCCAGCANCAATGGCAGTGACGGCGTTTGGCGGCGCGG
HKR387377 RBd68H09 pGCAP10 NM_016311.3  
GGTACCTTANAANNNNNTNCACTNNNNTCCGTGGGTGAAGANATTTGAGATGGNACCTTA
HKR391601 RBd79A01 pGCAP10 NM_016311.3  
ATGGAGAGACTGCTTGCTGCGGCAGAGACGCCAGAGGTGCNNCTCCAGCAGCAATGGCAG
HKR416014 RBdS040A14 pGCAP10 NM_016311.3  
GAGAGACGCCAGAGGTGCAGCTCCAGCAGCAATGGCAGTGACGGCGTTGGCGGCGCGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl