Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CAPZB

Gene ID (NCBI) 832
Gene Symbol CAPZB
Protein Name capping actin protein of muscle Z-line beta subunit
Synonyms CAPB|CAPPB|CAPZ
Databases KEGG hsa:832 |  NCBI Gene 832
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10365)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008637 IRAK021J21 pCMV-SPORT6 BC024601 NM_004930 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045780 ARe14H12 pKA1U5 NM_004930.2  
GACTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACT
HKR050882 ARe27D10 pKA1U5 NM_004930.2  
GGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACTGACGCCGGGACCGGGACCGC
HKR173683 ARi34D11 pGCAP10 NM_004930.2  
GGTTCACTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGC
HKR056881 ARe42D09 pKA1U5 NM_004930.2  
GAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACTGACGCCGGGACCGGGACCGCCGCCG
HKR176033 ARi40B09 pGCAP10 NM_004930.2  
GACTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACT
HKR184804 ARi62A04 pGCAP10 NM_004930.2  
GACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACTGACGCCGGGA
HKR184922 ARi62F02 pGCAP10 NM_004930.2  
GACTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACT
HKR379630 RBd49B06 pGCAP10 NM_004930.2  
GGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACTGACGCCGGGACCGGGACCGCCG
HKR380154 RBd50G10 pGCAP10 NM_004930.2  
GACTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACT
HKR386498 RBd66E02 pGCAP10 NM_004930.2  
GGGGANGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACTGACGCCGGGACCGGG
HKR392082 RBd80D10 pGCAP10 NM_004930.2  
GACTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACT
HKR403082 RBdS007L18 pGCAP10 NM_004930.2  
GACTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACT
HKR462745 RBdS156O09 pGCAP10 NM_004930.2  
GGTTCANTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl