Prev. |  Human A to Z list >  C >  CAPZB > 

ARe14H12 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR045780
Clone Name ARe14H12
Clone info. Plasmid clone of human CAPZB cDNA with SV40 promoter
Vector plasmidClick for information pKA1U5
5'-terminal sequence(1) GACTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACT
Sequence, submitted(2) n.a.
Note This clone is expected to contain 109-1757nt of NM_004930.4 (cds 204-1022nt).
 
Sequence, refered NM_004930.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) CAPZB (NCBI Gene 832) finder other clone of CAPZB in our bank
Synonyms CAPB|CAPPB|CAPZ
Protein Name capping protein (actin filament) muscle Z-line, beta
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR045780 ARe14H12 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2017.10.27

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_171016.pl