Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156O09

Clone ID RBdS156O09
HP ID HP00465
Gene ID 832
Gene Symbol CAPZB
Protein Name capping protein (actin filament) muscle Z-line, beta
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004930.2
Length of RefSeq (bp) 1647
Chromosome 1p36.1
Reference DDBJ accession
UniGene Hs.432760
5'-terminal sequence GGTTCANTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGC
2011.08.28