Prev. |  Human A to Z list >  C >  CAPZB > 

NRCD Human cDNA Clone - RBdS007L18

Ordering information ordering information
Catalog Number HKR403082
Clone Name RBdS007L18
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GACTCCTGGGCACCCGGGGAAGTGGAAGCGCCGGGCCCTGCTGCGGGGGGGAGAGCCACT
Sequence, submitted(2) Not available.
Description Plasmid clone of human CAPZB cDNA with SV40 promoter
 
HP ID HP00465  finder other clones in this HP group.
Sequence, refered (NCBI RefSeq mRNA) NM_004930.2
Gene ID 832
Gene Symbol CAPZB  finder other clones with this gene.
Synonyms CAPB|CAPPB|CAPZ
Protein Name capping protein (actin filament) muscle Z-line, beta
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available. please download the data . Click below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBdS007L18a.seq   RBdS007L18c.seq   RBdS007L18.pdf

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ).


2015.09.19

J:\Perl_src_\csv_set\NRCDhumcloneList_RB_140122.csv - GNP_filter3_NRCD_html_150711.pl