Resource data sheet
Prev.

pCMFlag_hsHIF1A

Expression vector of human HIF1A

Catalog number RDB06378
Resource name pCMFlag_hsHIF1A
Alternative name SET-0173_7
Clone info. Expression vector of human HIF1A. Expression was confirmed by Western blotting with anti-FLAG antibody.
Derived from Sugano BC012527. F-primer: gagggcgccggcggcgcgaa; R-primer: gctcagttaacttgatccaaagctctg.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human hypoxia-inducible factor 1 alpha subunit (HIF1A) cDNA
Depositor DNA Bank, |
 
Other clones in our bank human HIF1A (NCBI Gene 3091) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06378 pCMFlag_hsHIF1A DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF (map, protocol and/or remarks) RDB06378.pdf from Depositor

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB16934_A9Bfp1-1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB16934_A9Bfa.seq
>06378_16934_A9Bf_1_CMV-Forward_B09_02_ABI08.ab1
    1 TGTTTCCAAC CTCCCGGCCC CCTTTTGGAC GCAAATGGGC CGGGTAGGCG TGTACGGTGG
   61 GAGGTCTATA TAAGCAGAGC TCTCTGGCTA ACTAGAGAAC CCACTGCTTA CTGGCTTATC
  121 GAAATTAATA CGACTCACTA TAGGGAGACC CAAGCTGAAT TCACCATGGA CTACAAGGAC
  181 GATGACGATA AGGCGGCCGA GGGCGCCGGC GGCGCGAACG ACAAGAAAAA GATAAGTTCT
  241 GAACGTCGAA AAGAAAAGTC TCGAGATGCA GCCAGATCTC GGCGAAGTAA AGAATCTGAA
  301 GTTTTTTATG AGCTTGCTCA TCAGTTGCCA CTTCCACATA ATGTGAGTTC GCATCTTGAT
  361 AAGGCCTCTG TGATGAGGCT TACCATCAGC TATTTGCGTG TGAGGAAACT TCTGGATGCT
  421 GGTGATTTGG ATATTGAAGA TGACATGAAA GCACAGATGA ATTGCTTTTA TTTGAAAGCC
  481 TTGGATGGTT TTGTTATGGT TCTCACAGAT GATGGTGACA TGATTTACAT TTCTGATAAT
  541 GTGAACAAAT ACATGGGATT AACTCAGTTT GAACTAACTG GACACAGTGT GTTTGATTTT
  601 ACTCATCCAT GTGACCATGA GGAAATGAGA GAAATGCTTA CACACAGAAA TGGCCTTGTG
  661 AAAAAGGGTA AAGAACAAAA ACACACAGCG AAGCTTTTTT CTCAGAATGA AGTGTACCCT
  721 AACTAGCCGA GGAAGAACTA TGAACATAAA GTCTGCAACA TGGGAAGGTA TTGCACTGCA
  781 CAGGCCACAT TTCACGTATA TGATACCAAC AGTAACCAAC CTCAGTGTGG GGTATAAGAA
  841 AACCACCTAT GACCCTGCTT TGGTGCTGAT TTGTGGAACC CATTCCTCAC CCATCAAATA
  901 TTGAAAATTC CTTTTAGATA AGCAAGACGT TTCCTCAGTC GAACACAGCC TGGATATGAA
  961 AATTTTTCTT ATTTGTGATG AAAGAATTAC CGAATTGATG GGAATAATGA ACCCAGAAGA
 1021 CCTTTTAGGC CGGCTCAAAT TTTAGTGAAT ATTATCCATG CTTTTTGGAC TTCGTGAATT
 1081 CATTCTGACC GAGACCTTCA TTCAGTGATT ATGTTTACCA AGAGAACAAA GTCTCATCCA
 1141 CCAGGGAACA GTTACCAAGG AATGGCCTGT GCCAAAAGGA GGTGGGATTA TTGTTTCTCT
1201 GTGGCGGGTG TTGAGAAAAA CACTCTATCA GAGGCACAGA CG
//
Primer: BGH_rev2 RDB16934_A9Bfb.seq
>06378_16934_A9Bf_1_BGH_rev2_C09_03_ABI08.ab1
    1 CATAAAGGAA AAGGCCACGG GGGGGGAGGG GCAAACAACA GATGGCTGGC AACTAGAAGG
   61 CACAGTCGAG GCTGATCAGC GAGCTCTAGC ATTTAGGTGA CACTATAGAA TAGGGCCCTC
  121 TAGATGCATG CTCGAGCGGC CGCTCAGTTA ACTTGATCCA AAGCTCTGAG TAATTCTTCA
  181 CCCTGCAGTA GGTTTCTGCT GCCTTGTATA GGAGCATTAA CTTCACAATC ATAACTGGTC
  241 AGCTGTGGTA ATCCACTTTC ATCCATTGAT TGCCCCAGCA GTCTACATGC TAAATCAGAG
  301 GGTATTAAAA TAATTGTCTT TTGCTCCATT CCATTCTGTT CACTAGATTT GCATCCTTTT
  361 ACACGTTTCC AAGAAAGTGA TGTAGTAGCT GCATGATCGT CTGGCTGCTG TAATAATGTT
  421 CCAATTCCTA CTGCTTGAAA AAGTGAACCA TCATGTTCCA TTTTTCGCTT TCTCTGAGCA
  481 TTCTGCAAAG CTAGTATCTT TGGATTTAGT TCTTCCTCAG GAACTGTAGT TCTTTGACTC
  541 AAAGCGACAG ATAACACGTT AGGGCTTCTT GGATGAGATT TTTCTGTCTG TTCTATGACT
  601 CCTTTTCCTG CTCTGTTTGG TGAGGCTGTC CGACTTTGAG TATCTCTATA TGGTGATGAT
  661 GTGGCACTAG TAGTTTCTTT ATGTATGTGG GTAGGAGATG GAGATGCAAT CAATATTTTA
  721 ATGTCTTCCA TACGGTCTTT TGTCACTGTT TTTAATTCAT CAGTGGTGGC AGTGGTAGTG
  781 GTGGCATTAG CAGTAGGTTC TTGTATTTGA GTCTGCTGGA ATACTGGTAA CTGTGCTTTT
  841 GAGGACTTTG CGCTTTCAGG GGCTTGCGGA ACTGCTTTCT AATGGGTGAC ACTTGATCGA
  901 AAGGAACGTA ACTGGAAGTC ATTCATCCAA TTTGGGGATA TAGGGAGCTA AACATCCTCC
  961 CAATTCTAAA TCCTGGTGGT CCTGAAATTA GAAAAATGGG TTTCTTTGCC TTCCTGTGTC
 1021 CTTCCACCAA AAAGTTTTTT TCTCCCAATT TCCAAACTTT GGATTTCGTG TGACCATTAT
 1081 CACTATGTCG CAATAGAAAG CAATAATTTC ACCTGGGACT TATTAAGGGT CTTCAGGGTG
1141 G
//
Primer: SV40pro_F_ RDB16934_A9Bfc.seq
>06378_16934_A9Bf_1_SV40pro_F_D09_04_ABI08.ab1
    1 ACCTCGGGGC TGAGCTTTTC AGAAGTAGTG AGGAGGCTTT TTTGGAGGCC TAGGCTTTTG
   61 CAAAAAGCTC CCGGGAGCTT GGATATCCAT TTTCGGATCT GATCAAGAGA CAGGATGAGG
  121 ATCGTTTCGC ATGATTGAAC AAGATGGATT GCACGCAGGT TCTCCGGCCG CTTGGGTGGA
  181 GAGGCTATTC GGCTATGACT GGGCACAACA GACAATCGGC TGCTCTGATG CCGCCGTGTT
  241 CCGGCTGTCA GCGCAGGGGC GCCCGGTTCT TTTTGTCAAG ACCGACCTGT CCGGTGCCCT
  301 GAATGAACTG CAGGACGAGG CAGCGCGGCT ATCGTGGCTG GCCACGACGG GCGTTCCTTG
  361 CGCAGCTGTG CTCGACGTTG TCACTGAAGC GGGAAGGGAC TGGCTGCTAT TGGGCGAAGT
  421 GCCGGGGCAG GATCTCCTGT CATCTCACCT TGCTCCTGCC GAGAAAGTAT CCATCATGGC
  481 TGATGCAATG CGGCGGCTGC ATACGCTTGA TCCGGCTACC TGCCCATTCG ACCACCAAGC
  541 GAAACATCGC ATCGAGCGAG CACGTACTCG GATGGAAGCC GGTCTTGTCG ATCAGGATGA
  601 TCTGGACGAA GAGCATCAGG GGCTCGCGCC AGCCGAACTG TTCGCCAGGC TCAAGGCGCG
  661 CATGCCCGAC GGCGAGGATC TCGTCGTGAC CCATGGCGAT GCCTGCTTGC CGAATATCAT
  721 GGTGGAAAAT GGCCGCTTTT CTGGATTCAT CGACTGTGGC CGGCTGGGTG TGGGCGGACC
  781 GCTATCAGGA CATAGCGTTG GCTACCCGTG ATATTGCTGA AGAGCTTGGC GGCGAAATGG
  841 GCTGAACCGC TTCCTCGTGG CTTTACGGTA TCGCCGCTCC CGATTCGCAA GCGCATCGCC
  901 CTTCTATCGC CCTTCTTGAC GAGTTCTTCT GAGCGGGACT CTGGGGGTTC GAAATGACCG
  961 ACCAAGCGAA CGCCCCAACC TGGCCATCAC GAGATTTTCG ATTTCCACCG GCCGGCCTTC
 1021 TAATGGAAAG GGTTTGGGGC TTTCGGGATT TCGTTTTTCC GGGGACGGCC GGCTGGGAAT
 1081 GAATTCCCTC CCGAGCCGCG GGGGGATCTC AATGCTGGGA AGTTCCCTTT CGCCCACCCC
1141 TAACCTTGGT TTAATGGCAA GCCTTTAATA ATGGCTTACC AAGATGTAAA GACGAAGTA
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

user report Yoshida, T., Transcriptional upregulation of HIF-1 alpha by NF-kappaB/p65 and its associations with beta-catenin/p300 complexes in endometrial carcinoma cells. Lab. Invest., 93 (11): 1184-1193 (2013). PMID 24042437.

2019.06.20

GNP_filter3_RDBDEP_html_190430.pl