Prev. |  KEGG KO K08268 > 

RIKEN DNA Bank Human Resource - HIF1A

Gene ID NCBI Gene 3091 |  KEGG hsa:3091
Gene Symbol HIF1A
Protein Name hypoxia inducible factor 1 subunit alpha
Synonyms HIF-1-alpha|HIF-1A|HIF-1alpha|HIF1|HIF1-ALPHA|MOP1|PASD8|bHLHe78
Featured content HIF-1 signaling pathway - human
Ortholog resource in our bank

  HIF1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05523 pKM2L-phHIF1A Promoter Bank clone, Human hypoxia-inducible factor 1 alpha subunit (HIF1A) promoter
RDB06378 pCMFlag_hsHIF1A Expression vector of human HIF1A.
RDB07693 pGL4-phHIF1A Promoter collection, Human HIF1A promoter
RDB14403 pGEX-6P-3/GST-TAT-ODD/3-0-Casp3 Bacterial expression vector of protein prodrug TOP3 that is specifically processed and activated in hypoxia-inducible factor-active cells.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085660 IRAL014C12 pOTB7 BC012527 NM_001530 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169354 ARi23G10 pGCAP10 NM_001530.3  
GAGTGCTGCCTCGTCTGAGGGGACAGGAGGATCACCCTCTTCGTCGCTTCGGCCAGTGTG
HKR170881 ARi27D09 pGCAP10 NM_001530.3  
GAGTGCACAGTGCTGCCTCGTCTGAGGGGACAGGAGGATCACCCTCTTCGTCGCTTCGGC
HKR177377 ARi43H09 pGCAP10 NM_001530.3  
GGCACAGTGCTGCCTCGTCTGAGGGGACAGGAGGATCACCCTCTTCGTCGCTTCGGCCAG
HKR372406 RBd31A06 pGCAP10 NM_001530.3  
TGACAGTGCTGCCTCGTCTGAGGGGACAGGAGGATCACCCTCTTCGTCGCTTCGGCCAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl