Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11042

HP ID(1) HP11042
Gene ID(2)
Gene Symbol finder RBM19(exon 15, antisense)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 12q24.21
Reference DDBJ accession
UniGene Hs.577792

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd23F09 pGCAP10 GCCCCCCACTCTGAGCCCTTTATCTGGAGGTGAGGGTCTTGGTTGTGGGGAGATAAAACA
RBdS132N15 pGCAP10 GGACAGCAAAGACTGTTATCAGTTGCAAGCAGCTTTTCAGGACCTCCCCCCACTCTGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl