NRCD Human cDNA Clone - RBd23F09

Ordering information

Catalog Number HKR369329 Clone Name RBd23F09 Vector Click for information pGCAP10 Description Plasmid clone of human RBM19(exon 15, antisense) cDNA with SV40 promoter 5'-terminal sequence(1) GCCCCCCACTCTGAGCCCTTTATCTGGAGGTGAGGGTCTTGGTTGTGGGGAGATAAAACA Sequence, submitted(2) Not available.   HP ID HP11042   other clones in this HP group. Sequence, refered Gene ID Gene Symbol    other clones with this gene. Protein Name KEGG

Links

Full length sequence and restriction map are not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

2017.02.23