Prev. |  Human A to Z list >   >   > 

NRCD Human cDNA Clone - RBdS132N15

Ordering information ordering information
Catalog Number HKR453127
Clone Name RBdS132N15
Vector plasmidClick for information pGCAP10
Description Plasmid clone of human RBM19(exon 15, antisense) cDNA with SV40 promoter
5'-terminal sequence(1) GGACAGCAAAGACTGTTATCAGTTGCAAGCAGCTTTTCAGGACCTCCCCCCACTCTGAGC
Sequence, submitted(2) Not available.
 
HP ID HP11042  finder other clones in this HP group.
Sequence, refered
Gene ID
Gene Symbol   finder other clones with this gene.
Protein Name
KEGG link 01
Links

Full length sequence and restriction map are not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips


2017.02.23

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_160109.pl