Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10454

HP ID(1) HP10454
Gene ID(2) 26156
Gene Symbol finder RSL1D1
Protein Name ribosomal L1 domain containing 1
RefSeq NM_015659.2
Length of RefSeq (bp) 5137
Chromosome 16p13.13
Reference DDBJ accession
UniGene Hs.401842

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04B12 pKA1U5 GCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGATCTTCTGCA
ARe05B05 pKA1U5 GCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAG
ARe93D06 pKA1U5 GCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAG
ARi13D09 pGCAP10 GGTCTTCCGAGGCGGAAAGAGATGGAGGATTCGGCCTCNNNCTCGCTGGCTTCGGCAGCC
ARi38H09 pGCAP10 GCTCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGC
RBb51C08 pGCAP1 GGCGCCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCT
RBd20C07 pGCAP10 TGCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAGC
RBd22E09 pGCAP10
RBd35F10 pGCAP10 GCTTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAGC
RBd95F05 pGCAP10 GAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAGCCGCTACTGGAACCT
RBd99H12 pGCAP10 GGCACACGCGCCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTG
RBdS013N13 pGCAP10 GAGTGGGGTTGCACACGCGCCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCG
RBdS015E03 pGCAP10 TGAAGAAGCCAGCAGTGGGGTTGCACACGCGCCTCTTCACGAGGTGGAAACAAGATGGAG
RBdS110L07 pGCAP10 GAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAGCCGCTACTGGAACCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl