Prev. |  KEGG KO K14775 > 

RIKEN DNA Bank Human Resource - RSL1D1

Gene ID NCBI Gene 26156 |  KEGG hsa:26156
Gene Symbol RSL1D1
Protein Name ribosomal L1 domain containing 1
Synonyms CSIG|L12|PBK1|UTP30
Ortholog resources KEGG ortholog (KEGG orthology K14775) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04929 SEREX clone NGO-Pr-2 (ID 2283-4) #1 SEREX clone NGO-Pr-2 (ID 2283-4) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095867 IRAL039L03 pOTB7 BC019069 NM_015659 Full/var
HGY102970 IRAL057H02 pDNR-LIB BC070325 NM_015659

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE085242 M01C013B18 pDONR221 FLJ04-D09 AK000822 ENST00000355674  
HGE085290 M01C013D18 pDONR221 FLJ04-D09 AK000822 ENST00000355674  
HGE085338 M01C013F18 pDONR221 FLJ04-D09 AK000822 ENST00000355674  
HGE085386 M01C013H18 pDONR221 FLJ04-D09 AK000822 ENST00000355674  
HGE085434 M01C013J18 pDONR221 FLJ04-D09 AK000822 ENST00000355674  
HGE085482 M01C013L18 pDONR221 FLJ04-D09 AK000822 ENST00000355674  
HGE085530 M01C013N18 pDONR221 FLJ04-D09 AK000822 ENST00000355674  
HGE085578 M01C013P18 pDONR221 FLJ04-D09 AK000822 ENST00000355674  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041636 ARe04B12 pKA1U5 NM_015659.2  
GCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGATCTTCTGCA
HKR042029 ARe05B05 pKA1U5 NM_015659.2  
GCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAG
HKR077278 ARe93D06 pKA1U5 NM_015659.2  
GCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAG
HKR165281 ARi13D09 pGCAP10 NM_015659.2  
GGTCTTCCGAGGCGGAAAGAGATGGAGGATTCGGCCTCNNNCTCGCTGGCTTCGGCAGCC
HKR175377 ARi38H09 pGCAP10 NM_015659.2  
GCTCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGC
HKR340456 RBb51C08 pGCAP1 NM_015659.2  
GGCGCCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCT
HKR368055 RBd20C07 pGCAP10 NM_015659.2  
TGCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAGC
HKR368905 RBd22E09 pGCAP10 NM_015659.2  
HKR374130 RBd35F10 pGCAP10 NM_015659.2  
GCTTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAGC
HKR398125 RBd95F05 pGCAP10 NM_015659.2  
GAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAGCCGCTACTGGAACCT
HKR399780 RBd99H12 pGCAP10 NM_015659.2  
GGCACACGCGCCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTG
HKR405525 RBdS013N13 pGCAP10 NM_015659.2  
GAGTGGGGTTGCACACGCGCCTCTTCACGAGGTGGAAACAAGATGGAGGATTCGGCCTCG
HKR406099 RBdS015E03 pGCAP10 NM_015659.2  
TGAAGAAGCCAGCAGTGGGGTTGCACACGCGCCTCTTCACGAGGTGGAAACAAGATGGAG
HKR444271 RBdS110L07 pGCAP10 NM_015659.2  
GAAACAAGATGGAGGATTCGGCCTCGGCCTCGCTGTCTTCTGCAGCCGCTACTGGAACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl