Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015E03

Clone ID RBdS015E03
HP ID HP10454
Gene ID 26156
Gene Symbol RSL1D1
Protein Name ribosomal L1 domain containing 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015659.2
Length of RefSeq (bp) 5137
Chromosome 16p13.13
Reference DDBJ accession
UniGene Hs.401842
5'-terminal sequence TGAAGAAGCCAGCAGTGGGGTTGCACACGCGCCTCTTCACGAGGTGGAAACAAGATGGAG
2011.08.28