Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10172

HP ID(1) HP10172
Gene ID(2) 5955
Gene Symbol finder RCN2
Protein Name reticulocalbin 2, EF-hand calcium binding domain
RefSeq NM_002902.1
Length of RefSeq (bp) 1700
Chromosome 15q23
Reference DDBJ accession
UniGene Hs.79088

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe16E11 pKA1U5 TGGCCCGCGGAGCATCGCAGCCGGCCCGGGCCCCCGCCAGCCTCCCTCCTCGCGTCCCTC
ARi05H06 pGCAP10 GGCCCGCGGAGCATCGCAGCCGGCCCGGGCCCCCGCCAGCCTCCCTCCTCGCGTCCCTCG
ARiS096N17 pGCAP10 GGTAGCCNNCCGCGGAGCATCGCAGCCGGCCCGGGCCCCCGCCAGCCTCCCTCCTCNCGT
RBd37B04 pGCAP10 GAGCCTCCCTCCTCGCGTCCCTCGGTGTCCTCCGCGGGCCGGCGCGATGCGGCTGGGCCC
RBd58B10 pGCAP10 GGGAGCATCGCAGCCGGCCCGGGCCCCCGCCAGCCTCCCTCCNNNNNTCCCTCGGTGTCC
RBd92D09 pGCAP10 GGCGGAGCATCGCAGCCGGCCCGGGCCCCCGCCAGCCTCCCTCCTCGCGTCCCTCGGTGT
RBdS051B05 pGCAP10 GCCCCGCCAGCCTCCCTCCTCGCGTCCCTCGGTGTCCTCCGCGGGCCGGCGCGATGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl