Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051B05

Clone ID RBdS051B05
HP ID HP10172
Gene ID 5955
Gene Symbol RCN2
Protein Name reticulocalbin 2, EF-hand calcium binding domain
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002902.1
Length of RefSeq (bp) 1700
Chromosome 15q23
Reference DDBJ accession
UniGene Hs.79088
5'-terminal sequence GCCCCGCCAGCCTCCCTCCTCGCGTCCCTCGGTGTCCTCCGCGGGCCGGCGCGATGCGGC
2011.08.28