Prev. | 

RIKEN DNA Bank Human Resource - RCN2

Gene ID NCBI Gene 5955 |  KEGG hsa:5955
Gene Symbol RCN2
Protein Name reticulocalbin 2
Synonyms E6BP|ERC-55|ERC55|TCBP49
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083021 IRAL007J05 pOTB7 BC004892 NM_002902 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE034451 W01A086C03 pENTR-TOPO IRAL007J05 BC004892 NM_002902  
HGE034453 W01A086C05 pENTR-TOPO IRAL007J05 BC004892 NM_002902  
HGE034455 W01A086C07 pENTR-TOPO IRAL007J05 BC004892 NM_002902  
HGE034457 W01A086C09 pENTR-TOPO IRAL007J05 BC004892 NM_002902  
HGE034459 W01A086C11 pENTR-TOPO IRAL007J05 BC004892 NM_002902  
HGE034461 W01A086C13 pENTR-TOPO IRAL007J05 BC004892 NM_002902  
HGE034463 W01A086C15 pENTR-TOPO IRAL007J05 BC004892 NM_002902  
HGE034465 W01A086C17 pENTR-TOPO IRAL007J05 BC004892 NM_002902  
HGE034469 W01A086C21 pENTR-TOPO IRAL007J05 BC004892 NM_002902  
HGE034471 W01A086C23 pENTR-TOPO IRAL007J05 BC004892 NM_002902  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046507 ARe16E11 pKA1U5 NM_002902.1  
TGGCCCGCGGAGCATCGCAGCCGGCCCGGGCCCCCGCCAGCCTCCCTCCTCGCGTCCCTC
HKR162174 ARi05H06 pGCAP10 NM_002902.1  
GGCCCGCGGAGCATCGCAGCCGGCCCGGGCCCCCGCCAGCCTCCCTCCTCGCGTCCCTCG
HKR238729 ARiS096N17 pGCAP10 NM_002902.1  
GGTAGCCNNCCGCGGAGCATCGCAGCCGGCCCGGGCCCCCGCCAGCCTCCCTCCTCNCGT
HKR374828 RBd37B04 pGCAP10 NM_002902.1  
GAGCCTCCCTCCTCGCGTCCCTCGGTGTCCTCCGCGGGCCGGCGCGATGCGGCTGGGCCC
HKR383234 RBd58B10 pGCAP10 NM_002902.1  
GGGAGCATCGCAGCCGGCCCGGGCCCCCGCCAGCCTCCCTCCNNNNNTCCCTCGGTGTCC
HKR396881 RBd92D09 pGCAP10 NM_002902.1  
GGCGGAGCATCGCAGCCGGCCCGGGCCCCCGCCAGCCTCCCTCCTCGCGTCCCTCGGTGT
HKR420429 RBdS051B05 pGCAP10 NM_002902.1  
GCCCCGCCAGCCTCCCTCCTCGCGTCCCTCGGTGTCCTCCGCGGGCCGGCGCGATGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl