Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09245

HP ID(1) HP09245
Gene ID(2) 51132
Gene Symbol finder RLIM
Protein Name ring finger protein, LIM domain interacting
RefSeq NM_016120.3
Length of RefSeq (bp) 10590
Chromosome Xq13-q21
Reference DDBJ accession
UniGene Hs.653288

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS156K22 pGCAP10 GGCTGCTTGGTAACAATGGGGAAGATAATGGCTGCCTGAGCAACGTCTCCGAGCAGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl