Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156K22

Clone ID RBdS156K22
HP ID HP09245
Gene ID 51132
Gene Symbol RLIM
Protein Name ring finger protein, LIM domain interacting
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016120.3
Length of RefSeq (bp) 10590
Chromosome Xq13-q21
Reference DDBJ accession
UniGene Hs.653288
5'-terminal sequence GGCTGCTTGGTAACAATGGGGAAGATAATGGCTGCCTGAGCAACGTCTCCGAGCAGGCGC
2011.08.28