Prev. |  KEGG KO K16271 > 

RIKEN DNA Bank Human Resource - RLIM

Gene ID NCBI Gene 51132 |  KEGG hsa:51132
Gene Symbol RLIM
Protein Name ring finger protein, LIM domain interacting
Synonyms MRX61|NY-REN-43|RNF12
Ortholog resources KEGG ortholog (KEGG orthology K16271) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY089638 IRAL024B14 pOTB7 BC013357 NM_183353 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE107243 M01C068B19 pDONR221 06_08-G10 BC013357 NM_183353 done
HGE107291 M01C068D19 pDONR221 06_08-G10 BC013357 NM_183353  
HGE107339 M01C068F19 pDONR221 06_08-G10 BC013357 NM_183353  
HGE107387 M01C068H19 pDONR221 06_08-G10 BC013357 NM_183353  
HGE107435 M01C068J19 pDONR221 06_08-G10 BC013357 NM_183353  
HGE107483 M01C068L19 pDONR221 06_08-G10 BC013357 NM_183353  
HGE107531 M01C068N19 pDONR221 06_08-G10 BC013357 NM_183353  
HGE107579 M01C068P19 pDONR221 06_08-G10 BC013357 NM_183353  
HGE124816 M01C112A16 pDONR221 06-2_04-F08 BC013357 NM_183353  
HGE124864 M01C112C16 pDONR221 06-2_04-F08 BC013357 NM_183353  
HGE124912 M01C112E16 pDONR221 06-2_04-F08 BC013357 NM_183353  
HGE124960 M01C112G16 pDONR221 06-2_04-F08 BC013357 NM_183353  
HGE125008 M01C112I16 pDONR221 06-2_04-F08 BC013357 NM_183353  
HGE125056 M01C112K16 pDONR221 06-2_04-F08 BC013357 NM_183353  
HGE125104 M01C112M16 pDONR221 06-2_04-F08 BC013357 NM_183353  
HGE125152 M01C112O16 pDONR221 06-2_04-F08 BC013357 NM_183353  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025901 W01A064M13 pENTR-TOPO IRAL024B14 BC013357 NM_183353  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR462662 RBdS156K22 pGCAP10 NM_016120.3  
GGCTGCTTGGTAACAATGGGGAAGATAATGGCTGCCTGAGCAACGTCTCCGAGCAGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl