Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08939

HP ID(1) HP08939
Gene ID(2) 5662
Gene Symbol finder PSD
Protein Name pleckstrin and Sec7 domain containing
RefSeq NM_002779.3
Length of RefSeq (bp) 4183
Chromosome 10q24
Reference DDBJ accession
UniGene Hs.154658

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS022M17 pGCAP10 GGGGAGCCGCGCTGCCTTCACAGCTCAGCTGGGCCCAGCCTCTCCTCTGTCTCTCCTCGG
RBdS132G19 pGCAP10 GGCAGTGCGACAAATCTGGCGCTGTCCCCTTCAGCACCACGCGGAGTCCGCGCCGCCCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl