Prev. |  KEGG KO K12494 > 

RIKEN DNA Bank Human Resource - PSD

Gene ID NCBI Gene 5662 |  KEGG hsa:5662
Gene Symbol PSD
Protein Name pleckstrin and Sec7 domain containing
Synonyms EFA6|EFA6A|PSD1|TYL
Ortholog resources KEGG ortholog (KEGG orthology K12494) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR409105 RBdS022M17 pGCAP10 NM_002779.3  
GGGGAGCCGCGCTGCCTTCACAGCTCAGCTGGGCCCAGCCTCTCCTCTGTCTCTCCTCGG
HKR452963 RBdS132G19 pGCAP10 NM_002779.3  
GGCAGTGCGACAAATCTGGCGCTGTCCCCTTCAGCACCACGCGGAGTCCGCGCCGCCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl