Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PSD

Gene ID (NCBI) 5662
Gene Symbol PSD
Protein Name pleckstrin and Sec7 domain containing
Synonyms EFA6|EFA6A|PSD1|TYL
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR409105 RBdS022M17 pGCAP10 NM_002779.3  
GGGGAGCCGCGCTGCCTTCACAGCTCAGCTGGGCCCAGCCTCTCCTCTGTCTCTCCTCGG
HKR452963 RBdS132G19 pGCAP10 NM_002779.3  
GGCAGTGCGACAAATCTGGCGCTGTCCCCTTCAGCACCACGCGGAGTCCGCGCCGCCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl