Prev. |  Human A to Z list >  P >  PSD > 

RBdS132G19 - NRCD Human cDNA Clone

Catalog Number HKR452963
Clone Name RBdS132G19
Clone info. Plasmid clone of human PSD cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGCAGTGCGACAAATCTGGCGCTGTCCCCTTCAGCACCACGCGGAGTCCGCGCCGCCCCT
Sequence, submitted(3) n.a.
 
Sequence, refered NM_002779.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) PSD (NCBI Gene 5662)  other clone of PSD in our bank
Synonyms EFA6|EFA6A|PSD1|TYL
Protein Name pleckstrin and Sec7 domain containing
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR452963 RBdS132G19 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS132G19 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR452963).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.02

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl