Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022M17

Clone ID RBdS022M17
HP ID HP08939
Gene ID 5662
Gene Symbol PSD
Protein Name pleckstrin and Sec7 domain containing
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002779.3
Length of RefSeq (bp) 4183
Chromosome 10q24
Reference DDBJ accession
UniGene Hs.154658
5'-terminal sequence GGGGAGCCGCGCTGCCTTCACAGCTCAGCTGGGCCCAGCCTCTCCTCTGTCTCTCCTCGG
2011.08.28