Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08782

HP ID(1) HP08782
Gene ID(2) 5932
Gene Symbol finder RBBP8
Protein Name retinoblastoma binding protein 8
RefSeq NM_203291.1
Length of RefSeq (bp) 3249
Chromosome 18q11.2
Reference DDBJ accession
UniGene Hs.546282

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd97H03 pGCAP10 GGCGCGCGCGCTTGGGAGGTTTTTTGGCCAGACCCGCACGCGGAACCGGCGCGGGCACCT
RBdS022A16 pGCAP10 GGCGGGTCCGGCCGCCTCCGAGCCCGGCCGGCAGCCCCCGGCCTTAAAGCGCGGGCTGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl