Prev. |  KEGG KO K20773 > 

RIKEN DNA Bank Human Resource - RBBP8

Gene ID NCBI Gene 5932 |  KEGG hsa:5932
Gene Symbol RBBP8
Protein Name RB binding protein 8, endonuclease
Synonyms COM1|CTIP|JWDS|RIM|SAE2|SCKL2
Ortholog resources KEGG ortholog (KEGG orthology K20773) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013807 IRAK034I15 pBluescriptR BC030590 NM_203291 Full/var
HGY082418 IRAL006A18 pOTB7 BC001170 NM_203292 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE089602 M01C024A02 pDONR221 MGC01-F01 BC030590 NM_203291  
HGE089650 M01C024C02 pDONR221 MGC01-F01 BC030590 NM_203291  
HGE089698 M01C024E02 pDONR221 MGC01-F01 BC030590 NM_203291  
HGE089746 M01C024G02 pDONR221 MGC01-F01 BC030590 NM_203291  
HGE089794 M01C024I02 pDONR221 MGC01-F01 BC030590 NM_203291  
HGE089842 M01C024K02 pDONR221 MGC01-F01 BC030590 NM_203291  
HGE089890 M01C024M02 pDONR221 MGC01-F01 BC030590 NM_203291  
HGE089938 M01C024O02 pDONR221 MGC01-F01 BC030590 NM_203291  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR398971 RBd97H03 pGCAP10 NM_203291.1  
GGCGCGCGCGCTTGGGAGGTTTTTTGGCCAGACCCGCACGCGGAACCGGCGCGGGCACCT
HKR408816 RBdS022A16 pGCAP10 NM_203291.1  
GGCGGGTCCGGCCGCCTCCGAGCCCGGCCGGCAGCCCCCGGCCTTAAAGCGCGGGCTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl