Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022A16

Clone ID RBdS022A16
HP ID HP08782
Gene ID 5932
Gene Symbol RBBP8
Protein Name retinoblastoma binding protein 8
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_203291.1
Length of RefSeq (bp) 3249
Chromosome 18q11.2
Reference DDBJ accession
UniGene Hs.546282
5'-terminal sequence GGCGGGTCCGGCCGCCTCCGAGCCCGGCCGGCAGCCCCCGGCCTTAAAGCGCGGGCTGTC
2011.08.28