Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08229

HP ID(1) HP08229
Gene ID(2) 5915
Gene Symbol finder RARB
Protein Name retinoic acid receptor, beta
RefSeq NM_000965.3
Length of RefSeq (bp) 3142
Chromosome 3p24
Reference DDBJ accession
UniGene Hs.654490

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS194G21 pGCAP10 GAGTAGGAAGTGAGCTGTTCAGAGGCAGGAGGGTCTATTCTTTGCCAAAGGGGGGACCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl