Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - ARiS194G21

Clone ID ARiS194G21
HP ID finder HP08229
Gene ID 5915
Gene Symbol finder RARB
Protein Name retinoic acid receptor, beta
Vector(1) pGCAP10
Accession No. in DDBJ(2)(link)
RefSeq mRNA NM_000965.3
Reference DDBJ accession
UniGene Hs.654490
KEGG(3) (link) 5915
5'-terminal sequence(4) GAGTAGGAAGTGAGCTGTTCAGAGGCAGGAGGGTCTATTCTTTGCCAAAGGGGGGACCAG

Results of terminal sequence of the clone

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
PDF File
ARiS194G21a.seq   ARiS194G21c.seq ARiS194G21

Click finder to find other clones.
(1) Please visit plasmidVector Information for the inforation of vectors and sequence primers.
(2) Accession indicates DNA sequence of the insert.
(3) The Kyoto Encyclopedia of Genes and Genomes of the Kanehisa Laboratories in the Bioinformatics Center of Kyoto University and the Human Genome Center of the University of Tokyo.
(4) 5' terminal sequence of inserted fragment provided from the depositor is indicated.


2013.10.10

NRCDhumcloneList_AR.csv - GNP_filter3_NRCD_html.pl