Prev. |  KEGG KO K08528 > 

RIKEN DNA Bank Human Resource - RARB

Gene ID NCBI Gene 5915 |  KEGG hsa:5915
Gene Symbol RARB
Protein Name retinoic acid receptor beta
Synonyms HAP|MCOPS12|NR1B2|RARbeta1|RRB2
Ortholog resource in our bank

  RARB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07905 pGL4-phRARB Promoter collection, Human RARB promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX019980 IRAK049P20 pCMV-SPORT6 BC030234 NM_016152 Full/var
HGX039578 IRAK098P18 pCMV-SPORT6 BC050415 NM_016152 Full/var
HGY053342 IRAK133F22 pBluescript BC060794 NM_016152 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR277765 ARiS194G21 pGCAP10 NM_000965.3  
GAGTAGGAAGTGAGCTGTTCAGAGGCAGGAGGGTCTATTCTTTGCCAAAGGGGGGACCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl