Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07687

HP ID(1) HP07687
Gene ID(2) 57148
Gene Symbol finder RALGAPB
Protein Name Ral GTPase activating protein, beta subunit (non-catalytic)
RefSeq NM_020336.2
Length of RefSeq (bp) 8636
Chromosome 20q11.23
Reference DDBJ accession
UniGene Hs.598850

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi71D03 pGCAP10 GGAAGTTGCCTGAGCAGATCCCAGCCGGCTGGCTCGAGTGGCCTTCGTCGTCCCTTGGCG
RBd56G12 pGCAP10 AB621815 GGGGGGAAACCCGCGTAGCCGAGGGAGATGCAGCGCGCGGCGATGGTGCCATTTGGATTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl