Prev. |  Human A to Z list >  R >  RALGAPB > 

NRCD Human cDNA Clone - RBd56G12

Catalog Number HKR382556
Clone Name RBd56G12
Clone info. Plasmid clone of human RALGAPB cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GGGGGGAAACCCGCGTAGCCGAGGGAGATGCAGCGCGCGGCGATGGTGCCATTTGGATTG
Sequence, submitted(2) AB621815 link 01
 
Sequence, refered NM_020336.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RALGAPB (NCBI Gene 57148) finder other clones with this gene.
Synonyms KIAA1219|RalGAPbeta
Protein Name Ral GTPase activating protein, beta subunit (non-catalytic)
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR382556 RBd56G12 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl