Prev. | 

RIKEN DNA Bank Human Resource - RALGAPB

Gene ID NCBI Gene 57148 |  KEGG hsa:57148
Gene Symbol RALGAPB
Protein Name Ral GTPase activating protein non-catalytic subunit beta
Synonyms KIAA1219|RalGAPbeta
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY028203 IRAK070I11 pBluescriptR BC036425 NM_020336 Partial/var
HGY036468 IRAK091C20 pBluescript BC047482 NM_020336 Full
HGY087902 IRAL019M14 pDNR-LIB BC010916 NM_020336 Partial
HGY095460 IRAL038K20 pDNR-LIB BC018668 NM_020336 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE091211 M01C028A11 pDONR221 MGC03-E06 BC047482 NM_020336  
HGE091259 M01C028C11 pDONR221 MGC03-E06 BC047482 NM_020336  
HGE091307 M01C028E11 pDONR221 MGC03-E06 BC047482 NM_020336  
HGE091355 M01C028G11 pDONR221 MGC03-E06 BC047482 NM_020336  
HGE091403 M01C028I11 pDONR221 MGC03-E06 BC047482 NM_020336  
HGE091451 M01C028K11 pDONR221 MGC03-E06 BC047482 NM_020336  
HGE091499 M01C028M11 pDONR221 MGC03-E06 BC047482 NM_020336  
HGE091547 M01C028O11 pDONR221 MGC03-E06 BC047482 NM_020336  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR188475 ARi71D03 pGCAP10 NM_020336.2  
GGAAGTTGCCTGAGCAGATCCCAGCCGGCTGGCTCGAGTGGCCTTCGTCGTCCCTTGGCG
HKR382556 RBd56G12 pGCAP10 NM_020336.2  
GGGGGGAAACCCGCGTAGCCGAGGGAGATGCAGCGCGCGGCGATGGTGCCATTTGGATTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl