Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07562

HP ID(1) HP07562
Gene ID(2) 5869
Gene Symbol finder RAB5B
Protein Name RAB5B, member RAS oncogene family
RefSeq NM_002868.2
Length of RefSeq (bp) 3336
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.567328

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi48B06 pGCAP10 GGACACAGGCTTGGGGCCGACGGGGGAGACGGAGCCCCAGGAGTGTTGAAGCCTGGAAAT
RBdS110P22 pGCAP10 GGCAGCTGTTTGTCTGTTCGACACAGGCTTGGGGCCGACGGGGGAGACGGAGCCCCAGGA
RBdS156M24 pGCAP10 GGCAGCTGTTTGTCTGTTCGACACAGGCTTGGGGCCGACGGGGGAGACGGAGCCCCAGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl