Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110P22

Clone ID RBdS110P22
HP ID HP07562
Gene ID 5869
Gene Symbol RAB5B
Protein Name RAB5B, member RAS oncogene family
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002868.2
Length of RefSeq (bp) 3336
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.567328
5'-terminal sequence GGCAGCTGTTTGTCTGTTCGACACAGGCTTGGGGCCGACGGGGGAGACGGAGCCCCAGGA
2011.08.28