Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAB5B

Gene ID (NCBI) 5869
Gene Symbol RAB5B
Protein Name RAB5B, member RAS oncogene family
Synonyms -
Databases KEGG hsa:5869 |  NCBI Gene 5869
Featured content Endocytosis (human)
Featured content Rab Family - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07888)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX027888 IRAK069L24 pCMV-SPORT6 BC032740 NM_002868 Full
HGX033938 IRAK084O02 pCMV-SPORT6 BC040143 NM_002868 Full
HGX043120 IRAK107N08 pCMV-SPORT6 BC050558 NM_002868 Full
HGX047899 IRAK119M11 pCMV-SPORT6 BC056422 NM_002868 Full
HGX056226 IRAK140J10 pCMV-SPORT6 BC065298 NM_002868 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR179230 ARi48B06 pGCAP10 NM_002868.2  
GGACACAGGCTTGGGGCCGACGGGGGAGACGGAGCCCCAGGAGTGTTGAAGCCTGGAAAT
HKR444382 RBdS110P22 pGCAP10 NM_002868.2  
GGCAGCTGTTTGTCTGTTCGACACAGGCTTGGGGCCGACGGGGGAGACGGAGCCCCAGGA
HKR462712 RBdS156M24 pGCAP10 NM_002868.2  
GGCAGCTGTTTGTCTGTTCGACACAGGCTTGGGGCCGACGGGGGAGACGGAGCCCCAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.03.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190131.pl