Prev. | NRCD Clone A | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06949

HP ID(1) HP06949
Gene ID(2) 220202
Gene Symbol finder ATOH7
Protein Name atonal homolog 7 (Drosophila)
RefSeq NM_145178.2
Length of RefSeq (bp) 1487
Chromosome 10q21.3
Reference DDBJ accession
UniGene Hs.175396

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd08C12 pGCAP10 AB593108 GCTGCACTCTCCGACAGCTACTGCGCTAAAAGCGCTCCTTCCCTGAGCTTCGGGAAAGAG
RBd71C10 pGCAP10 GCTGCACTCTCCGACAGCTACTGCGCTAAAAGCGCTCCTTCCCTGAGCTTCGGGAAAGAG
RBdS007J13 pGCAP10 GCTGCACTCTCCGACAGCTACTGCGCTAAAAGCGCTCCTTCCCTGAGCTTCGGGAAAGAG
RBdS081C04 pGCAP10 GCTGCACTCTCCGACAGCTACTGCGCTAAAAGCGCTCCTTCCCTGAGCTTCGGGAAAGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl