Prev. |  KEGG KO K09083 > 

RIKEN DNA Bank Human Resource - ATOH7

Gene ID NCBI Gene 220202 |  KEGG hsa:220202
Gene Symbol ATOH7
Protein Name atonal bHLH transcription factor 7
Synonyms Math5|NCRNA|PHPVAR|RNANC|bHLHa13
Ortholog resource in our bank

  ATOH7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027956 IRAK069O20 pCMV-SPORT6 BC032621 NM_145178 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE035164 W01A087P04 pENTR-TOPO IRAK069O20 BC032621 NM_145178  
HGE035170 W01A087P10 pENTR-TOPO IRAK069O20 BC032621 NM_145178  
HGE035178 W01A087P18 pENTR-TOPO IRAK069O20 BC032621 NM_145178  
HGE035180 W01A087P20 pENTR-TOPO IRAK069O20 BC032621 NM_145178  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR363260 RBd08C12 pGCAP10 NM_145178.4 full cds  
GCTGCACTCTCCGACAGCTACTGCGCTAAAAGCGCTCCTTCCCTGAGCTTCGGGAAAGAG
HKR432452 RBdS081C04 pGCAP10 NM_145178.4 full cds  
GCTGCACTCTCCGACAGCTACTGCGCTAAAAGCGCTCCTTCCCTGAGCTTCGGGAAAGAG
HKR388458 RBd71C10 pGCAP10 NM_145178.2  
GCTGCACTCTCCGACAGCTACTGCGCTAAAAGCGCTCCTTCCCTGAGCTTCGGGAAAGAG
HKR403029 RBdS007J13 pGCAP10 NM_145178.2  
GCTGCACTCTCCGACAGCTACTGCGCTAAAAGCGCTCCTTCCCTGAGCTTCGGGAAAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl